Dr. Michael Kustanov a lead oncologist at Kiev identified following sequence of the gene that was implicated in a unique type of pre-cancer skin called Actinic Keratosis (AK) that causes lesions of the skin when exposed to sun. His lab was determined to edit the gene by CRISPR and restore normal skin in over 2.8 million world-wide. The sequence of the gene is given below:
5’ AAAGAGTATATTTCAGGTACGAGACGATGGAGGCGG 3’
3’ TTT CTCATATAAAGTCCATGC TCT GCTACCTCC GCC 5’
From the above information of the cancer gene
- Identify the sequence the group would have targeted. (Write the only the sequence that will be targeted. Be very specific No partial credits). Because of this PRECISION CRISPR is a powerful tool.
- The gene target is _____________________ nucleotides long
- What is the PAM sequence for the AK gene? Write down the sequence
- The PAM sequence is located upstream to the gene. True or False
- Cas9 induced double-strand breaks can be repaired by ……………………………………….or ………………………………………………
- During repair what is the source of random insertions, deletions, and indels? _______________
- What type of repair machinery do you think that Dr. Kustanov and his team would have resorted to contain the desired edit? _____________________
- Other than the repair machinery that they identified above in question # 7- What other important second tool will they need to edit the gene?___________
- How do you think Dr. Kustanov and his group identify the desired mutation of individual cell or cells that harbors a successful edit from different progeny of the injected animal or electroporated cells?____________________________________ and _____________________________________
Expert writers 